ID: 1076426826

View in Genome Browser
Species Human (GRCh38)
Location 10:130372951-130372973
Sequence ATTGGCTGGACAGCGACGAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076426826_1076426829 6 Left 1076426826 10:130372951-130372973 CCGTTCGTCGCTGTCCAGCCAAT No data
Right 1076426829 10:130372980-130373002 TCCCTCTCCTCTCTACCTCCAGG No data
1076426826_1076426834 18 Left 1076426826 10:130372951-130372973 CCGTTCGTCGCTGTCCAGCCAAT No data
Right 1076426834 10:130372992-130373014 CTACCTCCAGGGTCACCCCTTGG No data
1076426826_1076426831 7 Left 1076426826 10:130372951-130372973 CCGTTCGTCGCTGTCCAGCCAAT No data
Right 1076426831 10:130372981-130373003 CCCTCTCCTCTCTACCTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076426826 Original CRISPR ATTGGCTGGACAGCGACGAA CGG (reversed) Intergenic
No off target data available for this crispr