ID: 1076426827

View in Genome Browser
Species Human (GRCh38)
Location 10:130372965-130372987
Sequence GAGAGGGAACAAACATTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076426827_1076426831 -7 Left 1076426827 10:130372965-130372987 CCAGCCAATGTTTGTTCCCTCTC No data
Right 1076426831 10:130372981-130373003 CCCTCTCCTCTCTACCTCCAGGG No data
1076426827_1076426842 26 Left 1076426827 10:130372965-130372987 CCAGCCAATGTTTGTTCCCTCTC No data
Right 1076426842 10:130373014-130373036 GCTGCCTTTTATGCTGGGCTTGG No data
1076426827_1076426834 4 Left 1076426827 10:130372965-130372987 CCAGCCAATGTTTGTTCCCTCTC No data
Right 1076426834 10:130372992-130373014 CTACCTCCAGGGTCACCCCTTGG No data
1076426827_1076426829 -8 Left 1076426827 10:130372965-130372987 CCAGCCAATGTTTGTTCCCTCTC No data
Right 1076426829 10:130372980-130373002 TCCCTCTCCTCTCTACCTCCAGG No data
1076426827_1076426839 20 Left 1076426827 10:130372965-130372987 CCAGCCAATGTTTGTTCCCTCTC No data
Right 1076426839 10:130373008-130373030 CCCTTGGCTGCCTTTTATGCTGG No data
1076426827_1076426841 21 Left 1076426827 10:130372965-130372987 CCAGCCAATGTTTGTTCCCTCTC No data
Right 1076426841 10:130373009-130373031 CCTTGGCTGCCTTTTATGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076426827 Original CRISPR GAGAGGGAACAAACATTGGC TGG (reversed) Intergenic