ID: 1076426829

View in Genome Browser
Species Human (GRCh38)
Location 10:130372980-130373002
Sequence TCCCTCTCCTCTCTACCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076426826_1076426829 6 Left 1076426826 10:130372951-130372973 CCGTTCGTCGCTGTCCAGCCAAT No data
Right 1076426829 10:130372980-130373002 TCCCTCTCCTCTCTACCTCCAGG No data
1076426823_1076426829 30 Left 1076426823 10:130372927-130372949 CCAGGCAGGGCTGGCAGGTTGGG No data
Right 1076426829 10:130372980-130373002 TCCCTCTCCTCTCTACCTCCAGG No data
1076426825_1076426829 7 Left 1076426825 10:130372950-130372972 CCCGTTCGTCGCTGTCCAGCCAA No data
Right 1076426829 10:130372980-130373002 TCCCTCTCCTCTCTACCTCCAGG No data
1076426827_1076426829 -8 Left 1076426827 10:130372965-130372987 CCAGCCAATGTTTGTTCCCTCTC No data
Right 1076426829 10:130372980-130373002 TCCCTCTCCTCTCTACCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076426829 Original CRISPR TCCCTCTCCTCTCTACCTCC AGG Intergenic