ID: 1076426831 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:130372981-130373003 |
Sequence | CCCTCTCCTCTCTACCTCCA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1076426827_1076426831 | -7 | Left | 1076426827 | 10:130372965-130372987 | CCAGCCAATGTTTGTTCCCTCTC | No data | ||
Right | 1076426831 | 10:130372981-130373003 | CCCTCTCCTCTCTACCTCCAGGG | No data | ||||
1076426826_1076426831 | 7 | Left | 1076426826 | 10:130372951-130372973 | CCGTTCGTCGCTGTCCAGCCAAT | No data | ||
Right | 1076426831 | 10:130372981-130373003 | CCCTCTCCTCTCTACCTCCAGGG | No data | ||||
1076426825_1076426831 | 8 | Left | 1076426825 | 10:130372950-130372972 | CCCGTTCGTCGCTGTCCAGCCAA | No data | ||
Right | 1076426831 | 10:130372981-130373003 | CCCTCTCCTCTCTACCTCCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1076426831 | Original CRISPR | CCCTCTCCTCTCTACCTCCA GGG | Intergenic | ||