ID: 1076426831

View in Genome Browser
Species Human (GRCh38)
Location 10:130372981-130373003
Sequence CCCTCTCCTCTCTACCTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076426827_1076426831 -7 Left 1076426827 10:130372965-130372987 CCAGCCAATGTTTGTTCCCTCTC No data
Right 1076426831 10:130372981-130373003 CCCTCTCCTCTCTACCTCCAGGG No data
1076426826_1076426831 7 Left 1076426826 10:130372951-130372973 CCGTTCGTCGCTGTCCAGCCAAT No data
Right 1076426831 10:130372981-130373003 CCCTCTCCTCTCTACCTCCAGGG No data
1076426825_1076426831 8 Left 1076426825 10:130372950-130372972 CCCGTTCGTCGCTGTCCAGCCAA No data
Right 1076426831 10:130372981-130373003 CCCTCTCCTCTCTACCTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076426831 Original CRISPR CCCTCTCCTCTCTACCTCCA GGG Intergenic