ID: 1076428366

View in Genome Browser
Species Human (GRCh38)
Location 10:130383438-130383460
Sequence GGCCAGAGCCCACTCCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076428366_1076428373 24 Left 1076428366 10:130383438-130383460 CCTGCTGGGAGTGGGCTCTGGCC No data
Right 1076428373 10:130383485-130383507 ATCCTCCATCCTTCAATCTATGG No data
1076428366_1076428377 27 Left 1076428366 10:130383438-130383460 CCTGCTGGGAGTGGGCTCTGGCC No data
Right 1076428377 10:130383488-130383510 CTCCATCCTTCAATCTATGGGGG No data
1076428366_1076428378 28 Left 1076428366 10:130383438-130383460 CCTGCTGGGAGTGGGCTCTGGCC No data
Right 1076428378 10:130383489-130383511 TCCATCCTTCAATCTATGGGGGG No data
1076428366_1076428367 -8 Left 1076428366 10:130383438-130383460 CCTGCTGGGAGTGGGCTCTGGCC No data
Right 1076428367 10:130383453-130383475 CTCTGGCCCTTGTTCCAGACAGG No data
1076428366_1076428374 25 Left 1076428366 10:130383438-130383460 CCTGCTGGGAGTGGGCTCTGGCC No data
Right 1076428374 10:130383486-130383508 TCCTCCATCCTTCAATCTATGGG No data
1076428366_1076428368 -7 Left 1076428366 10:130383438-130383460 CCTGCTGGGAGTGGGCTCTGGCC No data
Right 1076428368 10:130383454-130383476 TCTGGCCCTTGTTCCAGACAGGG No data
1076428366_1076428376 26 Left 1076428366 10:130383438-130383460 CCTGCTGGGAGTGGGCTCTGGCC No data
Right 1076428376 10:130383487-130383509 CCTCCATCCTTCAATCTATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076428366 Original CRISPR GGCCAGAGCCCACTCCCAGC AGG (reversed) Intergenic
No off target data available for this crispr