ID: 1076428370

View in Genome Browser
Species Human (GRCh38)
Location 10:130383460-130383482
Sequence TGTAGGCCCTGTCTGGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076428370_1076428376 4 Left 1076428370 10:130383460-130383482 CCTTGTTCCAGACAGGGCCTACA No data
Right 1076428376 10:130383487-130383509 CCTCCATCCTTCAATCTATGGGG No data
1076428370_1076428377 5 Left 1076428370 10:130383460-130383482 CCTTGTTCCAGACAGGGCCTACA No data
Right 1076428377 10:130383488-130383510 CTCCATCCTTCAATCTATGGGGG No data
1076428370_1076428373 2 Left 1076428370 10:130383460-130383482 CCTTGTTCCAGACAGGGCCTACA No data
Right 1076428373 10:130383485-130383507 ATCCTCCATCCTTCAATCTATGG No data
1076428370_1076428381 28 Left 1076428370 10:130383460-130383482 CCTTGTTCCAGACAGGGCCTACA No data
Right 1076428381 10:130383511-130383533 GTTTACCCTCATACCCATATAGG No data
1076428370_1076428374 3 Left 1076428370 10:130383460-130383482 CCTTGTTCCAGACAGGGCCTACA No data
Right 1076428374 10:130383486-130383508 TCCTCCATCCTTCAATCTATGGG No data
1076428370_1076428378 6 Left 1076428370 10:130383460-130383482 CCTTGTTCCAGACAGGGCCTACA No data
Right 1076428378 10:130383489-130383511 TCCATCCTTCAATCTATGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076428370 Original CRISPR TGTAGGCCCTGTCTGGAACA AGG (reversed) Intergenic