ID: 1076428373

View in Genome Browser
Species Human (GRCh38)
Location 10:130383485-130383507
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076428369_1076428373 3 Left 1076428369 10:130383459-130383481 CCCTTGTTCCAGACAGGGCCTAC No data
Right 1076428373 10:130383485-130383507 ATCCTCCATCCTTCAATCTATGG No data
1076428371_1076428373 -5 Left 1076428371 10:130383467-130383489 CCAGACAGGGCCTACAAAATCCT No data
Right 1076428373 10:130383485-130383507 ATCCTCCATCCTTCAATCTATGG No data
1076428366_1076428373 24 Left 1076428366 10:130383438-130383460 CCTGCTGGGAGTGGGCTCTGGCC No data
Right 1076428373 10:130383485-130383507 ATCCTCCATCCTTCAATCTATGG No data
1076428370_1076428373 2 Left 1076428370 10:130383460-130383482 CCTTGTTCCAGACAGGGCCTACA No data
Right 1076428373 10:130383485-130383507 ATCCTCCATCCTTCAATCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076428373 Original CRISPR ATCCTCCATCCTTCAATCTA TGG Intergenic