ID: 1076428374

View in Genome Browser
Species Human (GRCh38)
Location 10:130383486-130383508
Sequence TCCTCCATCCTTCAATCTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076428369_1076428374 4 Left 1076428369 10:130383459-130383481 CCCTTGTTCCAGACAGGGCCTAC No data
Right 1076428374 10:130383486-130383508 TCCTCCATCCTTCAATCTATGGG No data
1076428371_1076428374 -4 Left 1076428371 10:130383467-130383489 CCAGACAGGGCCTACAAAATCCT No data
Right 1076428374 10:130383486-130383508 TCCTCCATCCTTCAATCTATGGG No data
1076428370_1076428374 3 Left 1076428370 10:130383460-130383482 CCTTGTTCCAGACAGGGCCTACA No data
Right 1076428374 10:130383486-130383508 TCCTCCATCCTTCAATCTATGGG No data
1076428366_1076428374 25 Left 1076428366 10:130383438-130383460 CCTGCTGGGAGTGGGCTCTGGCC No data
Right 1076428374 10:130383486-130383508 TCCTCCATCCTTCAATCTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076428374 Original CRISPR TCCTCCATCCTTCAATCTAT GGG Intergenic
No off target data available for this crispr