ID: 1076428378 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:130383489-130383511 |
| Sequence | TCCATCCTTCAATCTATGGG GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1076428369_1076428378 | 7 | Left | 1076428369 | 10:130383459-130383481 | CCCTTGTTCCAGACAGGGCCTAC | No data | ||
| Right | 1076428378 | 10:130383489-130383511 | TCCATCCTTCAATCTATGGGGGG | No data | ||||
| 1076428366_1076428378 | 28 | Left | 1076428366 | 10:130383438-130383460 | CCTGCTGGGAGTGGGCTCTGGCC | No data | ||
| Right | 1076428378 | 10:130383489-130383511 | TCCATCCTTCAATCTATGGGGGG | No data | ||||
| 1076428371_1076428378 | -1 | Left | 1076428371 | 10:130383467-130383489 | CCAGACAGGGCCTACAAAATCCT | No data | ||
| Right | 1076428378 | 10:130383489-130383511 | TCCATCCTTCAATCTATGGGGGG | No data | ||||
| 1076428370_1076428378 | 6 | Left | 1076428370 | 10:130383460-130383482 | CCTTGTTCCAGACAGGGCCTACA | No data | ||
| Right | 1076428378 | 10:130383489-130383511 | TCCATCCTTCAATCTATGGGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1076428378 | Original CRISPR | TCCATCCTTCAATCTATGGG GGG | Intergenic | ||