ID: 1076428381

View in Genome Browser
Species Human (GRCh38)
Location 10:130383511-130383533
Sequence GTTTACCCTCATACCCATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076428379_1076428381 -2 Left 1076428379 10:130383490-130383512 CCATCCTTCAATCTATGGGGGGT No data
Right 1076428381 10:130383511-130383533 GTTTACCCTCATACCCATATAGG No data
1076428380_1076428381 -6 Left 1076428380 10:130383494-130383516 CCTTCAATCTATGGGGGGTTTAC No data
Right 1076428381 10:130383511-130383533 GTTTACCCTCATACCCATATAGG No data
1076428375_1076428381 1 Left 1076428375 10:130383487-130383509 CCTCCATCCTTCAATCTATGGGG No data
Right 1076428381 10:130383511-130383533 GTTTACCCTCATACCCATATAGG No data
1076428372_1076428381 11 Left 1076428372 10:130383477-130383499 CCTACAAAATCCTCCATCCTTCA No data
Right 1076428381 10:130383511-130383533 GTTTACCCTCATACCCATATAGG No data
1076428370_1076428381 28 Left 1076428370 10:130383460-130383482 CCTTGTTCCAGACAGGGCCTACA No data
Right 1076428381 10:130383511-130383533 GTTTACCCTCATACCCATATAGG No data
1076428369_1076428381 29 Left 1076428369 10:130383459-130383481 CCCTTGTTCCAGACAGGGCCTAC No data
Right 1076428381 10:130383511-130383533 GTTTACCCTCATACCCATATAGG No data
1076428371_1076428381 21 Left 1076428371 10:130383467-130383489 CCAGACAGGGCCTACAAAATCCT No data
Right 1076428381 10:130383511-130383533 GTTTACCCTCATACCCATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076428381 Original CRISPR GTTTACCCTCATACCCATAT AGG Intergenic
No off target data available for this crispr