ID: 1076429679

View in Genome Browser
Species Human (GRCh38)
Location 10:130393028-130393050
Sequence CTGGCTACACAGATGTACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076429679_1076429687 24 Left 1076429679 10:130393028-130393050 CCCAAGTACATCTGTGTAGCCAG No data
Right 1076429687 10:130393075-130393097 GGTGATGCTGAGGTAACAAATGG No data
1076429679_1076429682 -7 Left 1076429679 10:130393028-130393050 CCCAAGTACATCTGTGTAGCCAG No data
Right 1076429682 10:130393044-130393066 TAGCCAGGCTTGTAAAAGTCAGG No data
1076429679_1076429684 -2 Left 1076429679 10:130393028-130393050 CCCAAGTACATCTGTGTAGCCAG No data
Right 1076429684 10:130393049-130393071 AGGCTTGTAAAAGTCAGGACAGG No data
1076429679_1076429688 30 Left 1076429679 10:130393028-130393050 CCCAAGTACATCTGTGTAGCCAG No data
Right 1076429688 10:130393081-130393103 GCTGAGGTAACAAATGGCCTTGG No data
1076429679_1076429685 3 Left 1076429679 10:130393028-130393050 CCCAAGTACATCTGTGTAGCCAG No data
Right 1076429685 10:130393054-130393076 TGTAAAAGTCAGGACAGGCAAGG No data
1076429679_1076429686 14 Left 1076429679 10:130393028-130393050 CCCAAGTACATCTGTGTAGCCAG No data
Right 1076429686 10:130393065-130393087 GGACAGGCAAGGTGATGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076429679 Original CRISPR CTGGCTACACAGATGTACTT GGG (reversed) Intergenic
No off target data available for this crispr