ID: 1076430086

View in Genome Browser
Species Human (GRCh38)
Location 10:130395588-130395610
Sequence CTGTTGTTCTAAAGAACAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076430082_1076430086 12 Left 1076430082 10:130395553-130395575 CCAGAGAAGTCTCCTTTGACTTA No data
Right 1076430086 10:130395588-130395610 CTGTTGTTCTAAAGAACAAAAGG No data
1076430081_1076430086 28 Left 1076430081 10:130395537-130395559 CCTGGCTTGCAGGGAGCCAGAGA No data
Right 1076430086 10:130395588-130395610 CTGTTGTTCTAAAGAACAAAAGG No data
1076430084_1076430086 0 Left 1076430084 10:130395565-130395587 CCTTTGACTTAGGCCTTGAAGAA No data
Right 1076430086 10:130395588-130395610 CTGTTGTTCTAAAGAACAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076430086 Original CRISPR CTGTTGTTCTAAAGAACAAA AGG Intergenic
No off target data available for this crispr