ID: 1076434818

View in Genome Browser
Species Human (GRCh38)
Location 10:130433088-130433110
Sequence GATGAAACGCCCCACCATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076434818_1076434823 20 Left 1076434818 10:130433088-130433110 CCTGCATGGTGGGGCGTTTCATC No data
Right 1076434823 10:130433131-130433153 ACGTTGGCTTCAGAGCAGGCGGG No data
1076434818_1076434824 25 Left 1076434818 10:130433088-130433110 CCTGCATGGTGGGGCGTTTCATC No data
Right 1076434824 10:130433136-130433158 GGCTTCAGAGCAGGCGGGCCAGG No data
1076434818_1076434820 4 Left 1076434818 10:130433088-130433110 CCTGCATGGTGGGGCGTTTCATC No data
Right 1076434820 10:130433115-130433137 GGCAAAGCTGCAGCAGACGTTGG No data
1076434818_1076434821 16 Left 1076434818 10:130433088-130433110 CCTGCATGGTGGGGCGTTTCATC No data
Right 1076434821 10:130433127-130433149 GCAGACGTTGGCTTCAGAGCAGG No data
1076434818_1076434822 19 Left 1076434818 10:130433088-130433110 CCTGCATGGTGGGGCGTTTCATC No data
Right 1076434822 10:130433130-130433152 GACGTTGGCTTCAGAGCAGGCGG No data
1076434818_1076434825 30 Left 1076434818 10:130433088-130433110 CCTGCATGGTGGGGCGTTTCATC No data
Right 1076434825 10:130433141-130433163 CAGAGCAGGCGGGCCAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076434818 Original CRISPR GATGAAACGCCCCACCATGC AGG (reversed) Intergenic
No off target data available for this crispr