ID: 1076434825

View in Genome Browser
Species Human (GRCh38)
Location 10:130433141-130433163
Sequence CAGAGCAGGCGGGCCAGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076434818_1076434825 30 Left 1076434818 10:130433088-130433110 CCTGCATGGTGGGGCGTTTCATC No data
Right 1076434825 10:130433141-130433163 CAGAGCAGGCGGGCCAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076434825 Original CRISPR CAGAGCAGGCGGGCCAGGAG AGG Intergenic
No off target data available for this crispr