ID: 1076435594

View in Genome Browser
Species Human (GRCh38)
Location 10:130439034-130439056
Sequence CAGGTAAGCAAACCTGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076435594_1076435600 11 Left 1076435594 10:130439034-130439056 CCAGGCTCAGGTTTGCTTACCTG No data
Right 1076435600 10:130439068-130439090 CCTGTCCTGCCTGCTTCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076435594 Original CRISPR CAGGTAAGCAAACCTGAGCC TGG (reversed) Intergenic
No off target data available for this crispr