ID: 1076437535

View in Genome Browser
Species Human (GRCh38)
Location 10:130456295-130456317
Sequence CTGGACTGTTTTGGGAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076437529_1076437535 4 Left 1076437529 10:130456268-130456290 CCAATCTGTGGGAAAGGAGCCTA No data
Right 1076437535 10:130456295-130456317 CTGGACTGTTTTGGGAAAGCAGG No data
1076437527_1076437535 6 Left 1076437527 10:130456266-130456288 CCCCAATCTGTGGGAAAGGAGCC No data
Right 1076437535 10:130456295-130456317 CTGGACTGTTTTGGGAAAGCAGG No data
1076437522_1076437535 21 Left 1076437522 10:130456251-130456273 CCAGATGAAACAAACCCCCAATC No data
Right 1076437535 10:130456295-130456317 CTGGACTGTTTTGGGAAAGCAGG No data
1076437528_1076437535 5 Left 1076437528 10:130456267-130456289 CCCAATCTGTGGGAAAGGAGCCT No data
Right 1076437535 10:130456295-130456317 CTGGACTGTTTTGGGAAAGCAGG No data
1076437520_1076437535 30 Left 1076437520 10:130456242-130456264 CCATGAGTCCCAGATGAAACAAA No data
Right 1076437535 10:130456295-130456317 CTGGACTGTTTTGGGAAAGCAGG No data
1076437526_1076437535 7 Left 1076437526 10:130456265-130456287 CCCCCAATCTGTGGGAAAGGAGC No data
Right 1076437535 10:130456295-130456317 CTGGACTGTTTTGGGAAAGCAGG No data
1076437521_1076437535 22 Left 1076437521 10:130456250-130456272 CCCAGATGAAACAAACCCCCAAT No data
Right 1076437535 10:130456295-130456317 CTGGACTGTTTTGGGAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076437535 Original CRISPR CTGGACTGTTTTGGGAAAGC AGG Intergenic
No off target data available for this crispr