ID: 1076437904

View in Genome Browser
Species Human (GRCh38)
Location 10:130459256-130459278
Sequence CAGGGAAGTCAGAGGGGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076437889_1076437904 10 Left 1076437889 10:130459223-130459245 CCCACCCTGACACAATCCAGACC No data
Right 1076437904 10:130459256-130459278 CAGGGAAGTCAGAGGGGTGGAGG No data
1076437892_1076437904 5 Left 1076437892 10:130459228-130459250 CCTGACACAATCCAGACCTAACC No data
Right 1076437904 10:130459256-130459278 CAGGGAAGTCAGAGGGGTGGAGG No data
1076437895_1076437904 -6 Left 1076437895 10:130459239-130459261 CCAGACCTAACCAAGCCCAGGGA No data
Right 1076437904 10:130459256-130459278 CAGGGAAGTCAGAGGGGTGGAGG No data
1076437891_1076437904 6 Left 1076437891 10:130459227-130459249 CCCTGACACAATCCAGACCTAAC No data
Right 1076437904 10:130459256-130459278 CAGGGAAGTCAGAGGGGTGGAGG No data
1076437890_1076437904 9 Left 1076437890 10:130459224-130459246 CCACCCTGACACAATCCAGACCT No data
Right 1076437904 10:130459256-130459278 CAGGGAAGTCAGAGGGGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076437904 Original CRISPR CAGGGAAGTCAGAGGGGTGG AGG Intergenic
No off target data available for this crispr