ID: 1076438476

View in Genome Browser
Species Human (GRCh38)
Location 10:130462875-130462897
Sequence AGATGCACACTGCAGTGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076438472_1076438476 -7 Left 1076438472 10:130462859-130462881 CCATGAGGGGTGATGGAGATGCA No data
Right 1076438476 10:130462875-130462897 AGATGCACACTGCAGTGGTGGGG No data
1076438470_1076438476 4 Left 1076438470 10:130462848-130462870 CCAGTGATGGGCCATGAGGGGTG No data
Right 1076438476 10:130462875-130462897 AGATGCACACTGCAGTGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076438476 Original CRISPR AGATGCACACTGCAGTGGTG GGG Intergenic
No off target data available for this crispr