ID: 1076444041

View in Genome Browser
Species Human (GRCh38)
Location 10:130499887-130499909
Sequence GGTATCCTGAGGCTCTGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076444035_1076444041 8 Left 1076444035 10:130499856-130499878 CCAGGAGCTTGTTCTCTAAGTTC No data
Right 1076444041 10:130499887-130499909 GGTATCCTGAGGCTCTGTCTGGG No data
1076444033_1076444041 24 Left 1076444033 10:130499840-130499862 CCCATGTGATCTCTGACCAGGAG No data
Right 1076444041 10:130499887-130499909 GGTATCCTGAGGCTCTGTCTGGG No data
1076444034_1076444041 23 Left 1076444034 10:130499841-130499863 CCATGTGATCTCTGACCAGGAGC No data
Right 1076444041 10:130499887-130499909 GGTATCCTGAGGCTCTGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076444041 Original CRISPR GGTATCCTGAGGCTCTGTCT GGG Intergenic
No off target data available for this crispr