ID: 1076445020

View in Genome Browser
Species Human (GRCh38)
Location 10:130508579-130508601
Sequence CTCAATTCTCACGTGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076445020_1076445027 11 Left 1076445020 10:130508579-130508601 CCTTCCCCCACGTGAGAATTGAG No data
Right 1076445027 10:130508613-130508635 TCTTTGTTTTCTGTGTGCAAGGG No data
1076445020_1076445026 10 Left 1076445020 10:130508579-130508601 CCTTCCCCCACGTGAGAATTGAG No data
Right 1076445026 10:130508612-130508634 TTCTTTGTTTTCTGTGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076445020 Original CRISPR CTCAATTCTCACGTGGGGGA AGG (reversed) Intergenic
No off target data available for this crispr