ID: 1076445962

View in Genome Browser
Species Human (GRCh38)
Location 10:130513995-130514017
Sequence TCCCCCATGCTGTTATTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076445961_1076445962 -4 Left 1076445961 10:130513976-130513998 CCTGTGTTTCGTGAAAGCTTCCC No data
Right 1076445962 10:130513995-130514017 TCCCCCATGCTGTTATTGAGTGG No data
1076445960_1076445962 13 Left 1076445960 10:130513959-130513981 CCTGGGAGGGGTCTGGGCCTGTG No data
Right 1076445962 10:130513995-130514017 TCCCCCATGCTGTTATTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076445962 Original CRISPR TCCCCCATGCTGTTATTGAG TGG Intergenic
No off target data available for this crispr