ID: 1076449175

View in Genome Browser
Species Human (GRCh38)
Location 10:130544455-130544477
Sequence GACACTGATGTCACTCCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076449173_1076449175 -1 Left 1076449173 10:130544433-130544455 CCAGTGAAGGTGGCATGTCATGG No data
Right 1076449175 10:130544455-130544477 GACACTGATGTCACTCCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076449175 Original CRISPR GACACTGATGTCACTCCTTC AGG Intergenic
No off target data available for this crispr