ID: 1076449847

View in Genome Browser
Species Human (GRCh38)
Location 10:130549401-130549423
Sequence CAAGGGAGCCCCACTGTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076449841_1076449847 8 Left 1076449841 10:130549370-130549392 CCGTAGGATTAGTGCCCTTATAA No data
Right 1076449847 10:130549401-130549423 CAAGGGAGCCCCACTGTGTGAGG No data
1076449846_1076449847 -7 Left 1076449846 10:130549385-130549407 CCTTATAAAATAGGCACAAGGGA No data
Right 1076449847 10:130549401-130549423 CAAGGGAGCCCCACTGTGTGAGG No data
1076449844_1076449847 -6 Left 1076449844 10:130549384-130549406 CCCTTATAAAATAGGCACAAGGG No data
Right 1076449847 10:130549401-130549423 CAAGGGAGCCCCACTGTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076449847 Original CRISPR CAAGGGAGCCCCACTGTGTG AGG Intergenic
No off target data available for this crispr