ID: 1076454505

View in Genome Browser
Species Human (GRCh38)
Location 10:130580431-130580453
Sequence CTGCCCTCAGAGACTTGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076454505_1076454507 4 Left 1076454505 10:130580431-130580453 CCTGCGCAAGTCTCTGAGGGCAG No data
Right 1076454507 10:130580458-130580480 GACTCAAAAAAGTGACAAGAGGG No data
1076454505_1076454506 3 Left 1076454505 10:130580431-130580453 CCTGCGCAAGTCTCTGAGGGCAG No data
Right 1076454506 10:130580457-130580479 AGACTCAAAAAAGTGACAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076454505 Original CRISPR CTGCCCTCAGAGACTTGCGC AGG (reversed) Intergenic
No off target data available for this crispr