ID: 1076456188

View in Genome Browser
Species Human (GRCh38)
Location 10:130598868-130598890
Sequence TACTTGTGTAGAGCATGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076456188_1076456191 24 Left 1076456188 10:130598868-130598890 CCAGAACATGCTCTACACAAGTA No data
Right 1076456191 10:130598915-130598937 AGTCTGCATTCTGCTGTTGTTGG No data
1076456188_1076456189 0 Left 1076456188 10:130598868-130598890 CCAGAACATGCTCTACACAAGTA No data
Right 1076456189 10:130598891-130598913 AACTTTATGTGTGCACTTGAAGG No data
1076456188_1076456190 1 Left 1076456188 10:130598868-130598890 CCAGAACATGCTCTACACAAGTA No data
Right 1076456190 10:130598892-130598914 ACTTTATGTGTGCACTTGAAGGG No data
1076456188_1076456192 25 Left 1076456188 10:130598868-130598890 CCAGAACATGCTCTACACAAGTA No data
Right 1076456192 10:130598916-130598938 GTCTGCATTCTGCTGTTGTTGGG No data
1076456188_1076456193 28 Left 1076456188 10:130598868-130598890 CCAGAACATGCTCTACACAAGTA No data
Right 1076456193 10:130598919-130598941 TGCATTCTGCTGTTGTTGGGTGG 0: 3
1: 67
2: 220
3: 540
4: 1326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076456188 Original CRISPR TACTTGTGTAGAGCATGTTC TGG (reversed) Intergenic
No off target data available for this crispr