ID: 1076456192

View in Genome Browser
Species Human (GRCh38)
Location 10:130598916-130598938
Sequence GTCTGCATTCTGCTGTTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076456188_1076456192 25 Left 1076456188 10:130598868-130598890 CCAGAACATGCTCTACACAAGTA No data
Right 1076456192 10:130598916-130598938 GTCTGCATTCTGCTGTTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076456192 Original CRISPR GTCTGCATTCTGCTGTTGTT GGG Intergenic
No off target data available for this crispr