ID: 1076456713

View in Genome Browser
Species Human (GRCh38)
Location 10:130604999-130605021
Sequence GAGGGTTGCATGGACATTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076456710_1076456713 -6 Left 1076456710 10:130604982-130605004 CCTCCATGGGGAGATGGGAGGGT No data
Right 1076456713 10:130604999-130605021 GAGGGTTGCATGGACATTGCAGG No data
1076456701_1076456713 21 Left 1076456701 10:130604955-130604977 CCAGCCTCGGAGTCTCAGAGGAG No data
Right 1076456713 10:130604999-130605021 GAGGGTTGCATGGACATTGCAGG No data
1076456702_1076456713 17 Left 1076456702 10:130604959-130604981 CCTCGGAGTCTCAGAGGAGTTGA No data
Right 1076456713 10:130604999-130605021 GAGGGTTGCATGGACATTGCAGG No data
1076456699_1076456713 30 Left 1076456699 10:130604946-130604968 CCTCGCAGTCCAGCCTCGGAGTC No data
Right 1076456713 10:130604999-130605021 GAGGGTTGCATGGACATTGCAGG No data
1076456711_1076456713 -9 Left 1076456711 10:130604985-130605007 CCATGGGGAGATGGGAGGGTTGC No data
Right 1076456713 10:130604999-130605021 GAGGGTTGCATGGACATTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076456713 Original CRISPR GAGGGTTGCATGGACATTGC AGG Intergenic
No off target data available for this crispr