ID: 1076456774

View in Genome Browser
Species Human (GRCh38)
Location 10:130605337-130605359
Sequence AGAGAGAAGCAGCTTGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076456761_1076456774 24 Left 1076456761 10:130605290-130605312 CCCGGGACAGGCAGTGGAAACCA No data
Right 1076456774 10:130605337-130605359 AGAGAGAAGCAGCTTGGGGAGGG No data
1076456760_1076456774 25 Left 1076456760 10:130605289-130605311 CCCCGGGACAGGCAGTGGAAACC No data
Right 1076456774 10:130605337-130605359 AGAGAGAAGCAGCTTGGGGAGGG No data
1076456762_1076456774 23 Left 1076456762 10:130605291-130605313 CCGGGACAGGCAGTGGAAACCAG No data
Right 1076456774 10:130605337-130605359 AGAGAGAAGCAGCTTGGGGAGGG No data
1076456766_1076456774 4 Left 1076456766 10:130605310-130605332 CCAGGAGCGGATGCTTGGCACCG No data
Right 1076456774 10:130605337-130605359 AGAGAGAAGCAGCTTGGGGAGGG No data
1076456759_1076456774 29 Left 1076456759 10:130605285-130605307 CCATCCCCGGGACAGGCAGTGGA No data
Right 1076456774 10:130605337-130605359 AGAGAGAAGCAGCTTGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076456774 Original CRISPR AGAGAGAAGCAGCTTGGGGA GGG Intergenic
No off target data available for this crispr