ID: 1076461008

View in Genome Browser
Species Human (GRCh38)
Location 10:130647442-130647464
Sequence CAGGAGCAGGAGTGGCCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076461008_1076461020 25 Left 1076461008 10:130647442-130647464 CCACAGGGCCACTCCTGCTCCTG No data
Right 1076461020 10:130647490-130647512 TGGTCTCTAGCTGTGTTCTCTGG No data
1076461008_1076461017 2 Left 1076461008 10:130647442-130647464 CCACAGGGCCACTCCTGCTCCTG No data
Right 1076461017 10:130647467-130647489 GCTGGCTGCTCCAAGGACAATGG No data
1076461008_1076461018 5 Left 1076461008 10:130647442-130647464 CCACAGGGCCACTCCTGCTCCTG No data
Right 1076461018 10:130647470-130647492 GGCTGCTCCAAGGACAATGGTGG No data
1076461008_1076461015 -5 Left 1076461008 10:130647442-130647464 CCACAGGGCCACTCCTGCTCCTG No data
Right 1076461015 10:130647460-130647482 TCCTGGGGCTGGCTGCTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076461008 Original CRISPR CAGGAGCAGGAGTGGCCCTG TGG (reversed) Intergenic
No off target data available for this crispr