ID: 1076462287

View in Genome Browser
Species Human (GRCh38)
Location 10:130655572-130655594
Sequence TCTCATGTGGGGGCGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076462287_1076462297 5 Left 1076462287 10:130655572-130655594 CCCTCCTCCGCCCCCACATGAGA No data
Right 1076462297 10:130655600-130655622 GAGAAAAGCCTCAGCCTAAATGG No data
1076462287_1076462300 21 Left 1076462287 10:130655572-130655594 CCCTCCTCCGCCCCCACATGAGA No data
Right 1076462300 10:130655616-130655638 TAAATGGAGCCTGCTGTGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076462287 Original CRISPR TCTCATGTGGGGGCGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr