ID: 1076462769

View in Genome Browser
Species Human (GRCh38)
Location 10:130657635-130657657
Sequence TATTCCTGGAGTGCATCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076462769_1076462776 3 Left 1076462769 10:130657635-130657657 CCTGTAGATGCACTCCAGGAATA No data
Right 1076462776 10:130657661-130657683 AACCTCCTGCAGGGGAGTTAAGG No data
1076462769_1076462773 -7 Left 1076462769 10:130657635-130657657 CCTGTAGATGCACTCCAGGAATA No data
Right 1076462773 10:130657651-130657673 AGGAATAGGGAACCTCCTGCAGG No data
1076462769_1076462779 11 Left 1076462769 10:130657635-130657657 CCTGTAGATGCACTCCAGGAATA No data
Right 1076462779 10:130657669-130657691 GCAGGGGAGTTAAGGAAATCAGG No data
1076462769_1076462780 12 Left 1076462769 10:130657635-130657657 CCTGTAGATGCACTCCAGGAATA No data
Right 1076462780 10:130657670-130657692 CAGGGGAGTTAAGGAAATCAGGG No data
1076462769_1076462782 29 Left 1076462769 10:130657635-130657657 CCTGTAGATGCACTCCAGGAATA No data
Right 1076462782 10:130657687-130657709 TCAGGGTCAGCAGTTCATCTGGG No data
1076462769_1076462774 -6 Left 1076462769 10:130657635-130657657 CCTGTAGATGCACTCCAGGAATA No data
Right 1076462774 10:130657652-130657674 GGAATAGGGAACCTCCTGCAGGG No data
1076462769_1076462775 -5 Left 1076462769 10:130657635-130657657 CCTGTAGATGCACTCCAGGAATA No data
Right 1076462775 10:130657653-130657675 GAATAGGGAACCTCCTGCAGGGG No data
1076462769_1076462781 28 Left 1076462769 10:130657635-130657657 CCTGTAGATGCACTCCAGGAATA No data
Right 1076462781 10:130657686-130657708 ATCAGGGTCAGCAGTTCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076462769 Original CRISPR TATTCCTGGAGTGCATCTAC AGG (reversed) Intergenic
No off target data available for this crispr