ID: 1076462795

View in Genome Browser
Species Human (GRCh38)
Location 10:130657791-130657813
Sequence CGTTCACTGCAGGAGCCACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076462795_1076462801 10 Left 1076462795 10:130657791-130657813 CCCCGTGGCTCCTGCAGTGAACG No data
Right 1076462801 10:130657824-130657846 ACCGTTCTGCAGTCACGTGTGGG No data
1076462795_1076462800 9 Left 1076462795 10:130657791-130657813 CCCCGTGGCTCCTGCAGTGAACG No data
Right 1076462800 10:130657823-130657845 CACCGTTCTGCAGTCACGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076462795 Original CRISPR CGTTCACTGCAGGAGCCACG GGG (reversed) Intergenic
No off target data available for this crispr