ID: 1076463674

View in Genome Browser
Species Human (GRCh38)
Location 10:130663920-130663942
Sequence CTTCCTTTTCACAAGAATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076463674_1076463677 5 Left 1076463674 10:130663920-130663942 CCATCATTCTTGTGAAAAGGAAG No data
Right 1076463677 10:130663948-130663970 GTCACAGGCTTATAATTGAATGG No data
1076463674_1076463676 -10 Left 1076463674 10:130663920-130663942 CCATCATTCTTGTGAAAAGGAAG No data
Right 1076463676 10:130663933-130663955 GAAAAGGAAGGAAAAGTCACAGG No data
1076463674_1076463678 24 Left 1076463674 10:130663920-130663942 CCATCATTCTTGTGAAAAGGAAG No data
Right 1076463678 10:130663967-130663989 ATGGTGAAGAAATTGTCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076463674 Original CRISPR CTTCCTTTTCACAAGAATGA TGG (reversed) Intergenic
No off target data available for this crispr