ID: 1076464012

View in Genome Browser
Species Human (GRCh38)
Location 10:130666130-130666152
Sequence AGTCCAATCCATGCTCTACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076464012_1076464015 20 Left 1076464012 10:130666130-130666152 CCACGTAGAGCATGGATTGGACT No data
Right 1076464015 10:130666173-130666195 GTCAGCTGTCATTGCAATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076464012 Original CRISPR AGTCCAATCCATGCTCTACG TGG (reversed) Intergenic
No off target data available for this crispr