ID: 1076466709

View in Genome Browser
Species Human (GRCh38)
Location 10:130687741-130687763
Sequence CATGAGCAGCACCGCTGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076466709_1076466715 10 Left 1076466709 10:130687741-130687763 CCAGTGCAGCGGTGCTGCTCATG No data
Right 1076466715 10:130687774-130687796 TCTGCACCATGCACACTGGGAGG No data
1076466709_1076466719 27 Left 1076466709 10:130687741-130687763 CCAGTGCAGCGGTGCTGCTCATG No data
Right 1076466719 10:130687791-130687813 GGGAGGCACGGCCGAGGCTGTGG No data
1076466709_1076466713 6 Left 1076466709 10:130687741-130687763 CCAGTGCAGCGGTGCTGCTCATG No data
Right 1076466713 10:130687770-130687792 GAGCTCTGCACCATGCACACTGG No data
1076466709_1076466718 21 Left 1076466709 10:130687741-130687763 CCAGTGCAGCGGTGCTGCTCATG No data
Right 1076466718 10:130687785-130687807 CACACTGGGAGGCACGGCCGAGG No data
1076466709_1076466714 7 Left 1076466709 10:130687741-130687763 CCAGTGCAGCGGTGCTGCTCATG No data
Right 1076466714 10:130687771-130687793 AGCTCTGCACCATGCACACTGGG No data
1076466709_1076466716 15 Left 1076466709 10:130687741-130687763 CCAGTGCAGCGGTGCTGCTCATG No data
Right 1076466716 10:130687779-130687801 ACCATGCACACTGGGAGGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076466709 Original CRISPR CATGAGCAGCACCGCTGCAC TGG (reversed) Intergenic
No off target data available for this crispr