ID: 1076469375

View in Genome Browser
Species Human (GRCh38)
Location 10:130708040-130708062
Sequence GCAGCTCCTGAGATTGGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076469370_1076469375 2 Left 1076469370 10:130708015-130708037 CCTGGGCATCCCTGTCTACACCT No data
Right 1076469375 10:130708040-130708062 GCAGCTCCTGAGATTGGAACAGG No data
1076469371_1076469375 -7 Left 1076469371 10:130708024-130708046 CCCTGTCTACACCTCTGCAGCTC No data
Right 1076469375 10:130708040-130708062 GCAGCTCCTGAGATTGGAACAGG No data
1076469366_1076469375 24 Left 1076469366 10:130707993-130708015 CCTGCAGTGACTGGACAGCAGCC No data
Right 1076469375 10:130708040-130708062 GCAGCTCCTGAGATTGGAACAGG No data
1076469372_1076469375 -8 Left 1076469372 10:130708025-130708047 CCTGTCTACACCTCTGCAGCTCC No data
Right 1076469375 10:130708040-130708062 GCAGCTCCTGAGATTGGAACAGG No data
1076469369_1076469375 3 Left 1076469369 10:130708014-130708036 CCCTGGGCATCCCTGTCTACACC No data
Right 1076469375 10:130708040-130708062 GCAGCTCCTGAGATTGGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076469375 Original CRISPR GCAGCTCCTGAGATTGGAAC AGG Intergenic
No off target data available for this crispr