ID: 1076469802

View in Genome Browser
Species Human (GRCh38)
Location 10:130710453-130710475
Sequence GAGTTTGCCACAGGCAGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076469792_1076469802 22 Left 1076469792 10:130710408-130710430 CCAGCATGGGGCTACATGGCCGA No data
Right 1076469802 10:130710453-130710475 GAGTTTGCCACAGGCAGGGATGG No data
1076469796_1076469802 3 Left 1076469796 10:130710427-130710449 CCGAGAGTGGTCGTTGGTGGCCA No data
Right 1076469802 10:130710453-130710475 GAGTTTGCCACAGGCAGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076469802 Original CRISPR GAGTTTGCCACAGGCAGGGA TGG Intergenic
No off target data available for this crispr