ID: 1076480721

View in Genome Browser
Species Human (GRCh38)
Location 10:130783673-130783695
Sequence GCGGGACTTTTCATGCTAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076480721_1076480731 0 Left 1076480721 10:130783673-130783695 CCCTTTAGCATGAAAAGTCCCGC No data
Right 1076480731 10:130783696-130783718 CTTGCAGAAGGGGCCGAGGGAGG No data
1076480721_1076480739 23 Left 1076480721 10:130783673-130783695 CCCTTTAGCATGAAAAGTCCCGC No data
Right 1076480739 10:130783719-130783741 GTCTGCTGGGGTGTCCACCGGGG No data
1076480721_1076480732 1 Left 1076480721 10:130783673-130783695 CCCTTTAGCATGAAAAGTCCCGC No data
Right 1076480732 10:130783697-130783719 TTGCAGAAGGGGCCGAGGGAGGG No data
1076480721_1076480734 10 Left 1076480721 10:130783673-130783695 CCCTTTAGCATGAAAAGTCCCGC No data
Right 1076480734 10:130783706-130783728 GGGCCGAGGGAGGGTCTGCTGGG No data
1076480721_1076480725 -10 Left 1076480721 10:130783673-130783695 CCCTTTAGCATGAAAAGTCCCGC No data
Right 1076480725 10:130783686-130783708 AAAGTCCCGCCTTGCAGAAGGGG No data
1076480721_1076480738 22 Left 1076480721 10:130783673-130783695 CCCTTTAGCATGAAAAGTCCCGC No data
Right 1076480738 10:130783718-130783740 GGTCTGCTGGGGTGTCCACCGGG No data
1076480721_1076480733 9 Left 1076480721 10:130783673-130783695 CCCTTTAGCATGAAAAGTCCCGC No data
Right 1076480733 10:130783705-130783727 GGGGCCGAGGGAGGGTCTGCTGG No data
1076480721_1076480729 -3 Left 1076480721 10:130783673-130783695 CCCTTTAGCATGAAAAGTCCCGC No data
Right 1076480729 10:130783693-130783715 CGCCTTGCAGAAGGGGCCGAGGG No data
1076480721_1076480735 11 Left 1076480721 10:130783673-130783695 CCCTTTAGCATGAAAAGTCCCGC No data
Right 1076480735 10:130783707-130783729 GGCCGAGGGAGGGTCTGCTGGGG No data
1076480721_1076480728 -4 Left 1076480721 10:130783673-130783695 CCCTTTAGCATGAAAAGTCCCGC No data
Right 1076480728 10:130783692-130783714 CCGCCTTGCAGAAGGGGCCGAGG No data
1076480721_1076480737 21 Left 1076480721 10:130783673-130783695 CCCTTTAGCATGAAAAGTCCCGC No data
Right 1076480737 10:130783717-130783739 GGGTCTGCTGGGGTGTCCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076480721 Original CRISPR GCGGGACTTTTCATGCTAAA GGG (reversed) Intergenic
No off target data available for this crispr