ID: 1076480723

View in Genome Browser
Species Human (GRCh38)
Location 10:130783684-130783706
Sequence GAAAAGTCCCGCCTTGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076480719_1076480723 -10 Left 1076480719 10:130783671-130783693 CCCCCTTTAGCATGAAAAGTCCC No data
Right 1076480723 10:130783684-130783706 GAAAAGTCCCGCCTTGCAGAAGG No data
1076480718_1076480723 -7 Left 1076480718 10:130783668-130783690 CCACCCCCTTTAGCATGAAAAGT No data
Right 1076480723 10:130783684-130783706 GAAAAGTCCCGCCTTGCAGAAGG No data
1076480717_1076480723 -6 Left 1076480717 10:130783667-130783689 CCCACCCCCTTTAGCATGAAAAG No data
Right 1076480723 10:130783684-130783706 GAAAAGTCCCGCCTTGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076480723 Original CRISPR GAAAAGTCCCGCCTTGCAGA AGG Intergenic
No off target data available for this crispr