ID: 1076480724

View in Genome Browser
Species Human (GRCh38)
Location 10:130783685-130783707
Sequence AAAAGTCCCGCCTTGCAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076480720_1076480724 -10 Left 1076480720 10:130783672-130783694 CCCCTTTAGCATGAAAAGTCCCG No data
Right 1076480724 10:130783685-130783707 AAAAGTCCCGCCTTGCAGAAGGG No data
1076480719_1076480724 -9 Left 1076480719 10:130783671-130783693 CCCCCTTTAGCATGAAAAGTCCC No data
Right 1076480724 10:130783685-130783707 AAAAGTCCCGCCTTGCAGAAGGG No data
1076480717_1076480724 -5 Left 1076480717 10:130783667-130783689 CCCACCCCCTTTAGCATGAAAAG No data
Right 1076480724 10:130783685-130783707 AAAAGTCCCGCCTTGCAGAAGGG No data
1076480718_1076480724 -6 Left 1076480718 10:130783668-130783690 CCACCCCCTTTAGCATGAAAAGT No data
Right 1076480724 10:130783685-130783707 AAAAGTCCCGCCTTGCAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076480724 Original CRISPR AAAAGTCCCGCCTTGCAGAA GGG Intergenic
No off target data available for this crispr