ID: 1076480727

View in Genome Browser
Species Human (GRCh38)
Location 10:130783692-130783714
Sequence CCTCGGCCCCTTCTGCAAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076480727_1076480743 19 Left 1076480727 10:130783692-130783714 CCGCCTTGCAGAAGGGGCCGAGG No data
Right 1076480743 10:130783734-130783756 CACCGGGGCATCTGTGTGAGGGG No data
1076480727_1076480737 2 Left 1076480727 10:130783692-130783714 CCGCCTTGCAGAAGGGGCCGAGG No data
Right 1076480737 10:130783717-130783739 GGGTCTGCTGGGGTGTCCACCGG No data
1076480727_1076480734 -9 Left 1076480727 10:130783692-130783714 CCGCCTTGCAGAAGGGGCCGAGG No data
Right 1076480734 10:130783706-130783728 GGGCCGAGGGAGGGTCTGCTGGG No data
1076480727_1076480739 4 Left 1076480727 10:130783692-130783714 CCGCCTTGCAGAAGGGGCCGAGG No data
Right 1076480739 10:130783719-130783741 GTCTGCTGGGGTGTCCACCGGGG No data
1076480727_1076480742 18 Left 1076480727 10:130783692-130783714 CCGCCTTGCAGAAGGGGCCGAGG No data
Right 1076480742 10:130783733-130783755 CCACCGGGGCATCTGTGTGAGGG No data
1076480727_1076480738 3 Left 1076480727 10:130783692-130783714 CCGCCTTGCAGAAGGGGCCGAGG No data
Right 1076480738 10:130783718-130783740 GGTCTGCTGGGGTGTCCACCGGG No data
1076480727_1076480735 -8 Left 1076480727 10:130783692-130783714 CCGCCTTGCAGAAGGGGCCGAGG No data
Right 1076480735 10:130783707-130783729 GGCCGAGGGAGGGTCTGCTGGGG No data
1076480727_1076480733 -10 Left 1076480727 10:130783692-130783714 CCGCCTTGCAGAAGGGGCCGAGG No data
Right 1076480733 10:130783705-130783727 GGGGCCGAGGGAGGGTCTGCTGG No data
1076480727_1076480747 29 Left 1076480727 10:130783692-130783714 CCGCCTTGCAGAAGGGGCCGAGG No data
Right 1076480747 10:130783744-130783766 TCTGTGTGAGGGGGTGCTGGTGG No data
1076480727_1076480744 20 Left 1076480727 10:130783692-130783714 CCGCCTTGCAGAAGGGGCCGAGG No data
Right 1076480744 10:130783735-130783757 ACCGGGGCATCTGTGTGAGGGGG No data
1076480727_1076480748 30 Left 1076480727 10:130783692-130783714 CCGCCTTGCAGAAGGGGCCGAGG No data
Right 1076480748 10:130783745-130783767 CTGTGTGAGGGGGTGCTGGTGGG No data
1076480727_1076480746 26 Left 1076480727 10:130783692-130783714 CCGCCTTGCAGAAGGGGCCGAGG No data
Right 1076480746 10:130783741-130783763 GCATCTGTGTGAGGGGGTGCTGG No data
1076480727_1076480740 17 Left 1076480727 10:130783692-130783714 CCGCCTTGCAGAAGGGGCCGAGG No data
Right 1076480740 10:130783732-130783754 TCCACCGGGGCATCTGTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076480727 Original CRISPR CCTCGGCCCCTTCTGCAAGG CGG (reversed) Intergenic
No off target data available for this crispr