ID: 1076480730

View in Genome Browser
Species Human (GRCh38)
Location 10:130783695-130783717
Sequence CTCCCTCGGCCCCTTCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076480730_1076480747 26 Left 1076480730 10:130783695-130783717 CCTTGCAGAAGGGGCCGAGGGAG No data
Right 1076480747 10:130783744-130783766 TCTGTGTGAGGGGGTGCTGGTGG No data
1076480730_1076480749 28 Left 1076480730 10:130783695-130783717 CCTTGCAGAAGGGGCCGAGGGAG No data
Right 1076480749 10:130783746-130783768 TGTGTGAGGGGGTGCTGGTGGGG No data
1076480730_1076480746 23 Left 1076480730 10:130783695-130783717 CCTTGCAGAAGGGGCCGAGGGAG No data
Right 1076480746 10:130783741-130783763 GCATCTGTGTGAGGGGGTGCTGG No data
1076480730_1076480740 14 Left 1076480730 10:130783695-130783717 CCTTGCAGAAGGGGCCGAGGGAG No data
Right 1076480740 10:130783732-130783754 TCCACCGGGGCATCTGTGTGAGG No data
1076480730_1076480742 15 Left 1076480730 10:130783695-130783717 CCTTGCAGAAGGGGCCGAGGGAG No data
Right 1076480742 10:130783733-130783755 CCACCGGGGCATCTGTGTGAGGG No data
1076480730_1076480748 27 Left 1076480730 10:130783695-130783717 CCTTGCAGAAGGGGCCGAGGGAG No data
Right 1076480748 10:130783745-130783767 CTGTGTGAGGGGGTGCTGGTGGG No data
1076480730_1076480750 29 Left 1076480730 10:130783695-130783717 CCTTGCAGAAGGGGCCGAGGGAG No data
Right 1076480750 10:130783747-130783769 GTGTGAGGGGGTGCTGGTGGGGG No data
1076480730_1076480739 1 Left 1076480730 10:130783695-130783717 CCTTGCAGAAGGGGCCGAGGGAG No data
Right 1076480739 10:130783719-130783741 GTCTGCTGGGGTGTCCACCGGGG No data
1076480730_1076480737 -1 Left 1076480730 10:130783695-130783717 CCTTGCAGAAGGGGCCGAGGGAG No data
Right 1076480737 10:130783717-130783739 GGGTCTGCTGGGGTGTCCACCGG No data
1076480730_1076480743 16 Left 1076480730 10:130783695-130783717 CCTTGCAGAAGGGGCCGAGGGAG No data
Right 1076480743 10:130783734-130783756 CACCGGGGCATCTGTGTGAGGGG No data
1076480730_1076480738 0 Left 1076480730 10:130783695-130783717 CCTTGCAGAAGGGGCCGAGGGAG No data
Right 1076480738 10:130783718-130783740 GGTCTGCTGGGGTGTCCACCGGG No data
1076480730_1076480744 17 Left 1076480730 10:130783695-130783717 CCTTGCAGAAGGGGCCGAGGGAG No data
Right 1076480744 10:130783735-130783757 ACCGGGGCATCTGTGTGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076480730 Original CRISPR CTCCCTCGGCCCCTTCTGCA AGG (reversed) Intergenic
No off target data available for this crispr