ID: 1076480732

View in Genome Browser
Species Human (GRCh38)
Location 10:130783697-130783719
Sequence TTGCAGAAGGGGCCGAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076480720_1076480732 2 Left 1076480720 10:130783672-130783694 CCCCTTTAGCATGAAAAGTCCCG No data
Right 1076480732 10:130783697-130783719 TTGCAGAAGGGGCCGAGGGAGGG No data
1076480719_1076480732 3 Left 1076480719 10:130783671-130783693 CCCCCTTTAGCATGAAAAGTCCC No data
Right 1076480732 10:130783697-130783719 TTGCAGAAGGGGCCGAGGGAGGG No data
1076480717_1076480732 7 Left 1076480717 10:130783667-130783689 CCCACCCCCTTTAGCATGAAAAG No data
Right 1076480732 10:130783697-130783719 TTGCAGAAGGGGCCGAGGGAGGG No data
1076480721_1076480732 1 Left 1076480721 10:130783673-130783695 CCCTTTAGCATGAAAAGTCCCGC No data
Right 1076480732 10:130783697-130783719 TTGCAGAAGGGGCCGAGGGAGGG No data
1076480718_1076480732 6 Left 1076480718 10:130783668-130783690 CCACCCCCTTTAGCATGAAAAGT No data
Right 1076480732 10:130783697-130783719 TTGCAGAAGGGGCCGAGGGAGGG No data
1076480722_1076480732 0 Left 1076480722 10:130783674-130783696 CCTTTAGCATGAAAAGTCCCGCC No data
Right 1076480732 10:130783697-130783719 TTGCAGAAGGGGCCGAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076480732 Original CRISPR TTGCAGAAGGGGCCGAGGGA GGG Intergenic
No off target data available for this crispr