ID: 1076480738

View in Genome Browser
Species Human (GRCh38)
Location 10:130783718-130783740
Sequence GGTCTGCTGGGGTGTCCACC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076480726_1076480738 4 Left 1076480726 10:130783691-130783713 CCCGCCTTGCAGAAGGGGCCGAG No data
Right 1076480738 10:130783718-130783740 GGTCTGCTGGGGTGTCCACCGGG No data
1076480719_1076480738 24 Left 1076480719 10:130783671-130783693 CCCCCTTTAGCATGAAAAGTCCC No data
Right 1076480738 10:130783718-130783740 GGTCTGCTGGGGTGTCCACCGGG No data
1076480722_1076480738 21 Left 1076480722 10:130783674-130783696 CCTTTAGCATGAAAAGTCCCGCC No data
Right 1076480738 10:130783718-130783740 GGTCTGCTGGGGTGTCCACCGGG No data
1076480717_1076480738 28 Left 1076480717 10:130783667-130783689 CCCACCCCCTTTAGCATGAAAAG No data
Right 1076480738 10:130783718-130783740 GGTCTGCTGGGGTGTCCACCGGG No data
1076480730_1076480738 0 Left 1076480730 10:130783695-130783717 CCTTGCAGAAGGGGCCGAGGGAG No data
Right 1076480738 10:130783718-130783740 GGTCTGCTGGGGTGTCCACCGGG No data
1076480727_1076480738 3 Left 1076480727 10:130783692-130783714 CCGCCTTGCAGAAGGGGCCGAGG No data
Right 1076480738 10:130783718-130783740 GGTCTGCTGGGGTGTCCACCGGG No data
1076480720_1076480738 23 Left 1076480720 10:130783672-130783694 CCCCTTTAGCATGAAAAGTCCCG No data
Right 1076480738 10:130783718-130783740 GGTCTGCTGGGGTGTCCACCGGG No data
1076480721_1076480738 22 Left 1076480721 10:130783673-130783695 CCCTTTAGCATGAAAAGTCCCGC No data
Right 1076480738 10:130783718-130783740 GGTCTGCTGGGGTGTCCACCGGG No data
1076480718_1076480738 27 Left 1076480718 10:130783668-130783690 CCACCCCCTTTAGCATGAAAAGT No data
Right 1076480738 10:130783718-130783740 GGTCTGCTGGGGTGTCCACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076480738 Original CRISPR GGTCTGCTGGGGTGTCCACC GGG Intergenic
No off target data available for this crispr