ID: 1076480748

View in Genome Browser
Species Human (GRCh38)
Location 10:130783745-130783767
Sequence CTGTGTGAGGGGGTGCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076480736_1076480748 13 Left 1076480736 10:130783709-130783731 CCGAGGGAGGGTCTGCTGGGGTG No data
Right 1076480748 10:130783745-130783767 CTGTGTGAGGGGGTGCTGGTGGG No data
1076480727_1076480748 30 Left 1076480727 10:130783692-130783714 CCGCCTTGCAGAAGGGGCCGAGG No data
Right 1076480748 10:130783745-130783767 CTGTGTGAGGGGGTGCTGGTGGG No data
1076480730_1076480748 27 Left 1076480730 10:130783695-130783717 CCTTGCAGAAGGGGCCGAGGGAG No data
Right 1076480748 10:130783745-130783767 CTGTGTGAGGGGGTGCTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076480748 Original CRISPR CTGTGTGAGGGGGTGCTGGT GGG Intergenic
No off target data available for this crispr