ID: 1076482645

View in Genome Browser
Species Human (GRCh38)
Location 10:130794859-130794881
Sequence GCAGGTGCACAGGATGGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076482641_1076482645 -5 Left 1076482641 10:130794841-130794863 CCGTGTGCTCAGCGTCTTGCAGG No data
Right 1076482645 10:130794859-130794881 GCAGGTGCACAGGATGGTGCAGG No data
1076482640_1076482645 -4 Left 1076482640 10:130794840-130794862 CCCGTGTGCTCAGCGTCTTGCAG No data
Right 1076482645 10:130794859-130794881 GCAGGTGCACAGGATGGTGCAGG No data
1076482639_1076482645 18 Left 1076482639 10:130794818-130794840 CCTCGGGGCAGAGGCTAAGGTGC No data
Right 1076482645 10:130794859-130794881 GCAGGTGCACAGGATGGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076482645 Original CRISPR GCAGGTGCACAGGATGGTGC AGG Intergenic
No off target data available for this crispr