ID: 1076482651

View in Genome Browser
Species Human (GRCh38)
Location 10:130794914-130794936
Sequence ACTGCACCTGTTTTATGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076482646_1076482651 1 Left 1076482646 10:130794890-130794912 CCTGCACGCCAACTTTGAAACAA No data
Right 1076482651 10:130794914-130794936 ACTGCACCTGTTTTATGGGGAGG No data
1076482647_1076482651 -7 Left 1076482647 10:130794898-130794920 CCAACTTTGAAACAATACTGCAC No data
Right 1076482651 10:130794914-130794936 ACTGCACCTGTTTTATGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076482651 Original CRISPR ACTGCACCTGTTTTATGGGG AGG Intergenic
No off target data available for this crispr