ID: 1076483024

View in Genome Browser
Species Human (GRCh38)
Location 10:130797182-130797204
Sequence AAGGAGCCTCCAGTTTGTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076483015_1076483024 17 Left 1076483015 10:130797142-130797164 CCTGAGGGAATTCCACAACCTGG No data
Right 1076483024 10:130797182-130797204 AAGGAGCCTCCAGTTTGTTGTGG No data
1076483014_1076483024 28 Left 1076483014 10:130797131-130797153 CCTGGGGGGTTCCTGAGGGAATT No data
Right 1076483024 10:130797182-130797204 AAGGAGCCTCCAGTTTGTTGTGG No data
1076483013_1076483024 29 Left 1076483013 10:130797130-130797152 CCCTGGGGGGTTCCTGAGGGAAT No data
Right 1076483024 10:130797182-130797204 AAGGAGCCTCCAGTTTGTTGTGG No data
1076483023_1076483024 -8 Left 1076483023 10:130797167-130797189 CCGTGATCATGGAAAAAGGAGCC No data
Right 1076483024 10:130797182-130797204 AAGGAGCCTCCAGTTTGTTGTGG No data
1076483019_1076483024 5 Left 1076483019 10:130797154-130797176 CCACAACCTGGGGCCGTGATCAT No data
Right 1076483024 10:130797182-130797204 AAGGAGCCTCCAGTTTGTTGTGG No data
1076483021_1076483024 -1 Left 1076483021 10:130797160-130797182 CCTGGGGCCGTGATCATGGAAAA No data
Right 1076483024 10:130797182-130797204 AAGGAGCCTCCAGTTTGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076483024 Original CRISPR AAGGAGCCTCCAGTTTGTTG TGG Intergenic
No off target data available for this crispr