ID: 1076485797 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:130816242-130816264 |
| Sequence | GGATCCTCAGAACAGCATCG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1076485794_1076485797 | -10 | Left | 1076485794 | 10:130816229-130816251 | CCATGACCCTATGGGATCCTCAG | No data | ||
| Right | 1076485797 | 10:130816242-130816264 | GGATCCTCAGAACAGCATCGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1076485797 | Original CRISPR | GGATCCTCAGAACAGCATCG TGG | Intergenic | ||