ID: 1076485797

View in Genome Browser
Species Human (GRCh38)
Location 10:130816242-130816264
Sequence GGATCCTCAGAACAGCATCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076485794_1076485797 -10 Left 1076485794 10:130816229-130816251 CCATGACCCTATGGGATCCTCAG No data
Right 1076485797 10:130816242-130816264 GGATCCTCAGAACAGCATCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076485797 Original CRISPR GGATCCTCAGAACAGCATCG TGG Intergenic