ID: 1076488939

View in Genome Browser
Species Human (GRCh38)
Location 10:130843391-130843413
Sequence CACTTGGTACAGATTCCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076488939_1076488943 6 Left 1076488939 10:130843391-130843413 CCTGGGGGAATCTGTACCAAGTG No data
Right 1076488943 10:130843420-130843442 CTAGCTCAGGAATCCCAGGCTGG No data
1076488939_1076488942 2 Left 1076488939 10:130843391-130843413 CCTGGGGGAATCTGTACCAAGTG No data
Right 1076488942 10:130843416-130843438 ACAACTAGCTCAGGAATCCCAGG No data
1076488939_1076488944 12 Left 1076488939 10:130843391-130843413 CCTGGGGGAATCTGTACCAAGTG No data
Right 1076488944 10:130843426-130843448 CAGGAATCCCAGGCTGGAGAAGG No data
1076488939_1076488941 -7 Left 1076488939 10:130843391-130843413 CCTGGGGGAATCTGTACCAAGTG No data
Right 1076488941 10:130843407-130843429 CCAAGTGACACAACTAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076488939 Original CRISPR CACTTGGTACAGATTCCCCC AGG (reversed) Intergenic
No off target data available for this crispr